《On the Edge of Eureka》Carbonarious Scientarum
Advertisement
Acidalia’s mind filled to the brim with rising panic, and her whole body seemed poised for a fight-or-flight reaction, but she couldn’t move. If she left the tile where she was standing, everything she’d done could be erased, wiped away like chalk from a blackboard in the name of security. That was usually not a problem—it’d be easy enough for a trained Cipher to recreate the code—but under circumstances like these, she couldn’t afford to begin all over again; she might never have the chance to finish. The Nova were out there somewhere, lurking in the mist and the effervescent, bubbling moisture, poised to kill. It wasn’t that Acidalia couldn’t afford to die—she absolutely could—but she had to get this done first.
“Do you have any idea who the people behind us are?” she asked into her headset, praying that Andromeda was listening. Then she remembered that there could be no communication between the inside of the Terminal and the outside—everything here was locked down to the very maximum, and teams of people trying to speak to each other all at once were suspicious. Ciphers worked alone, and they operated on their own time. If anyone wanted to speak to a busy Imperatrix, they’d just have to wait. So Acidalia and Lyra were truly alone this time—completely and utterly solitary, with no backup and no plan.
Faex.
“See if you can hold them off,” Acidalia called to Lyra, knowing full well that Lyra wouldn’t be able to keep them away for more than a millisecond. Alpha was probably just as useless, nothing more than a glorified tour guide, and there was nobody else around to help.
“How?” Lyra asked, sounding nervous.
“Just shoot at them, or throw things at them, or something. You don’t have to kill them, just keep them distracted long enough for me to come finish them off.” She pulled out a tiny bomb, big enough to make some noise but not big enough to work against an army, and tossed it to Lyra. “Here. Just keep them busy.” There was no way Acidalia could fight a whole team of people at once, but it was better than admitting defeat. Sweaty from the fear and shaking from the adrenaline, she went back to her console, trying to focus on anything but the people behind her.
AUCUGGGGCAUCGGCUGUAAUCCA
Ile-Trp-Gly-Ile-Gly-Cys-Asn-Pro…
DNA turned to RNA turned to animo acids turned to proteins. Virions came together molecule by molecule like tiny, lethal nanobots, poised to take flight. The outdated, glowing displays hurt Acidalia’s eyes more than the gas had, but she continued ever onwards, typing and typing. Between the letters and the laser lights, she’d began to tear up, and it was a stupid thought, but she couldn’t help but ruminate on how downright pathetic she’d look if she died and they found her corpse bloodied and tearstained.
No. You cannot do this right now. Her conscious mind overtook her scared subconscious, burying the primal anxiety deep inside of her. Get back to what you’re doing. You can have a panic attack later. Besides, this isn’t what T would have wanted. He died for you, don’t just throw your life away.
More DNA. More proteins. MA. CA. SP1. NC. SP2. p6. Reverse transcriptase. Integrase. Protease. It was coming together now, coming together like Frankenstein’s monster, ready to wreak havoc on the world.
Behind Acidalia, a laser bolt went off, and Lyra shrieked.
Don’t panic. Don’t let them win this, the reasonable part of her brain screamed.
Lyra is dead and you’re next, the primal part of her brain screamed back.
Advertisement
She steadied herself, clinging onto the railing. You’re so damn close. Viruses were easy, especially retroviruses; they were small, biologically speaking. A couple thousand base pairs. That was simple. Acidalia could make that in twenty minutes. All that was left to do was send it out, press that bright blue button that blinked, beckoningly, from the foreground, and she was free to die however she pleased because the damage will have already been done. Painstakingly, she chose the area of influence for the plague she’d created, drawing borders by hand, watching the biology necessary for airborne transmission fall into place like dominos. Then, confident in her abilities, she pressed her hand down on the button, and fractured light scattered in a million directions.
The console blinked one last time, and it was over. Shaking, she leant back against the railing. The mist was bitter cold. She felt very, very small, utterly defenseless, because she was one person against an army, against the whole Nova, and God only knew how many people were there and where Lyra was, or if Lyra was dead, or what the consequences of both of them dying would be. Would her death spark an interstellar war? Acidalia wondered. Would those alien people go after Alestra instead? What would she do to them, and what would they do to her in return? How many innocents would die in the crossfire of this hypothetical but likely war?
What would her death doom her planet to?
The vapor was rising, swallowing her whole. She wanted to just lay there in the fading light and fall asleep. She’d done that once, when she was very little and her mother was here. There was something comforting about this place and the power it held. About the fact that, to the computers, she and Alestra were equal.
But she couldn’t afford sleep. She wasn’t as safe here as she had once been.
“Something wrong?” a cold, feminine voice asked from behind her. Acidalia turned around slowly, hands thumbing the trigger of her blaster gun.
“Cassiopeia.” It was a statement, not a question.
“You’re surrounded,” she said. “Drop the weapon.”
“I’ll kill myself before I let you have me,” Acidalia snapped. It was a last resort, but she was reasonably certain that they wanted her alive. She had valuable knowledge. They might not want to take their biggest asset dead, and she might be able to bide some time. Slowly, she put her blaster to her own head, fingers not-quite on the trigger.
Well, this is definitely the most suicidal thing I’ve ever done, she thought.
“Fine,” Cassiopeia said hurriedly. “We’ll negotiate. Put the weapon down.”
“Not until we come to an agreement,” she said. “You know I’m not one to mindlessly obey.” In between the words, she scanned the room for Lyra. Alpha stood against the door, apparently switched off, but unharmed otherwise, and the Cantator was nowhere to be seen.
“Maybe this will help you change your mind,” Cassiopeia said, and stepped backwards. There was a moment of utter quietude, then a small teenage girl stepped forwards, white-blonde hair rippling in the disorienting light.
Aleskynn. That’s how they got in here. Of course—if Acidalia was dead, or at least supposed to be, her sister would be next in line. And, due to the rule of two, Aleskynn technically had Imperial powers despite being a principissa. Never in a million lightyears had Acidalia thought that her sister would be capable of welding her influence in any capacity whatsoever, nor that Cassiopeia would be able to convince her to.
Advertisement
Now that she thought about it, Cassiopeia had been so willing to kill her before, to the point where she’d literally had a gun to Acidalia’s head and was threatening to pull the trigger. What had caused her to change her stance so suddenly? Maybe she’d gained some common sense and realized that murdering someone with this much knowledge of the enemy’s plans was foolhardy, but that didn’t sound like Cassiopeia. She wasn’t smart enough to think of that on her own—she wouldn’t have not taken the chance to kill Acidalia when presented with an opportunity, and she wouldn’t have ever thought to use Aleskynn to her advantage. There had to be someone else behind this plan, keeping Cassiopeia in check and keeping Aleskynn happy enough to want to help them.
Acidalia glanced at her sister. Aleskynn did look as if she was here willingly; she kicked at the ground with casual indifference, and her blue eyes were bored, distracted. Acidalia had learned years ago to read the secrets of the court, to see the tells of lies, and Aleskynn was never a very good actress. Cassiopeia was acting like they could hurt her if Acidalia didn’t cooperate, but she simply didn’t look like a captive. Besides, they needed a Cipher if they wanted to get in to places like this.
“Drop the weapon, now,” Cassiopeia said. The side of her face blinked neon; the place where Acidalia had smashed her head in with the butt of the gun had been replaced by metal and wire, cutting through pale flesh and onyx-dark hair. It wasn’t as obvious as Andromeda’s cybernetics, but it was visible, and even somewhat shoddy in a way that suggested quick, reckless work. Aleskynn remained stony and silent, with the same pout she used when Alestra told her she couldn’t wear a certain dress or a ridiculous color of lipstick.
“Why are you here?” Acidalia asked, keeping the blaster pointed directly at her skull. She wondered if she could move it just enough so it would go past her head, hit some other body part instead, and make it look like she was dead. If she angled it downwards, it would hit her shoulder. If she timed it right, she could make it look like she shot herself, if she collapsed to the ground and stayed down. The mist would help hide her, and she could maybe get into a duct—but that was a long shot, and those ducts couldn’t support a human for very long. And then there was the question of Lyra.
“You know why I’m here,” Cassiopeia said. “To bring you to justice.”
“Why?” Acidalia asked. She didn’t even care what twisted things were going through Cassiopeia’s mind, but the open-ended questions kept her talking, and if she was talking, she was distracted. Scanning the room, Acidalia didn’t see much backup; there were soldiers by the entrance and the exit, but their numbers were small. If she detonated one of the bombs in her belt, she could probably kill the majority of them. She didn’t doubt that there were more craft outside, but they wouldn’t want to bomb the Terminal now, lest they risk killing everyone in it.
“I’m going to do it right this time,” Cassiopeia replied, fixing her steely eyes on Acidalia’s deep brown ones. “Your friends are dead, Acidalia. Your cause is hopeless. The rest of the planet already thinks you’re lying cold in your grave.” Her words were stilted, robotic. They didn’t sound like they were coming from Cassiopeia. It seemed like someone was speaking through her, like her body was but a vessel for another soul. Alestra, maybe? But something told Acidalia that Alestra might not know about this. Her mother doted on Aleskynn—she would never willingly send her youngest daughter into battle if there was any chance she might not come back. And even if Alestra was a complete monster who was willing to have her pride and joy murdered, that’d leave her and Eleutheria without an heir, and she’d have to go through the trouble of making a replacement princess all over again. It didn’t make any sense.
“If the entire planet already thinks I’m dead, what difference does it make if I die now?” Acidalia asked.
“Just drop the goddamn gun!” Cassiopeia screamed, her eyes flaring brightly. “Futue te ipsum, moecha puti-“
The word was only halfway out of her mouth before her face went slack, her eyes turning dark again. Acidalia quirked an eyebrow. She’d gone from unhinged to utterly unresponsive. Then Cassiopeia, or whoever was possessing Cassiopeia, spoke again.
“Join us,” she—they?—offered. “Join us, and you’ll never have to run around with the filth your party thinks of as people ever again. You are an Imperial and the daughter of Alestra Cipher. She may have mercy on you if you return to her now. Do not forget your roots, Acidalia.”
“I’m some Martian man’s bastard daughter who had the misfortune of being born to the psychopath your party calls your queen,” Acidalia said. “The Imperial crown is irrelevant.” She angled the blaster gun down ever so slightly, pointing it at her shoulder. If something happened—she didn’t need much, just a loud noise or an unexpected shot—she could pretend she was spooked and shoot herself, and the shot would only half-destroy her non-dominant arm. That was the best thing about these little laser pulse shots—they didn’t rip through flesh like traditional bullets, they could be set to different strengths. Then they’d think her a dead woman and they’d be off their guard, and she might be able to escape into the mist.
“Face it,” said Cassiopeia, or whoever was speaking through her. “In a few minutes, you will either be shackled and incoherent or a corpse on the ground like your friend if you remain allegiant to your current party.”
“How am I supposed to know that you’re not going to torture me anyway once you have me on your side?’” Acidalia asked. “I don’t trust you.” A corpse on the ground like your friend? she asked herself. There was no way they’d already killed Lyra. She had information, too.
“Well, you aren’t exactly in a position to make demands, Cipher.” Cassiopeia was seething with a quiet sort of anger, unlike her normal screaming rage. “Never underestimate the pain a person can endure before they die. I know ten thousand ways to make you suffer before you drown in your own fluids. Join us now and I might have mercy.”
It was the type of thing that ordinarily would have seemed over-the-top and trying-too-hard, but the fact that it was coming out of a woman who never sounded even remotely like that was unnerving. It was also incredibly monotone, like the person behind it didn’t know how to sound like a normal human. Combined with the uncanny, vibrant vapor and the lights, it made Acidalia’s stomach churn.
“Or,” Cassiopeia continued, still slack-jawed and blank, “you can join this meretrix in death.” She shot a laser bolt into the mist, forcing it to clear for a brief second. On the ground, beneath the vapor, was Lyra. Her pink hair hid her face, and her blood coated the floor in slick red. Acidalia was suddenly nauseous. That girl was only fifteen…
But she was moving. Not enough for Cassiopeia to see it from how far away she was, but enough that Acidalia could tell she was alive. Her chest rose and fell, and her eyelashes fluttered with unlabored, easy breaths. She wasn't dead—injured, maybe, but not severely. The blood had to be her wounds from before—laser shots didn’t make their victims bleed. Lyra was very much alive, and pretending she wasn’t. And Lyra had bombs in her belt.
Hoping it would be clear enough, Acidalia fingered the pockets of her belt on Lyra’s side. Her pink hair moved slightly. It could have been a breeze, but it could have been her lifting her head.
“I’ve made my decision,” Acidalia announced. “I will join-“
Cassiopeia’s eyes lit up.
“-my brother in hell.”
She pulled the trigger. and the world erupted.
Burning pain shot down her arm, searing her neck, leaving a trail of blisters along her back. She shrieked involuntarily, collapsing to the ground. Somewhere in the room, Aleskynn screamed, her shouts reverberating throughout the chamber until they were distorted cries of pain. Acidalia suddenly felt horrible. It was bad enough that she’d had to watch T die, but Aleskynn had practically just watched her sister kill herself.
I’m so sorry, she thought. I’m sorry, but it had to be done.
Acidalia curled up on the ground underneath the mist, motionless. She shifted her shoulder so that the nasty burn would be immediately visible to anyone who came close and stared into the distance, eyes blank and unmoving. Internally, she counted the seconds.
“Is she dead?!” Aleskynn demanded. “Cassiopeia, is she dead? You promised me you wouldn’t kill her, Cass!”
A soldier in bloodstained white ambled over slowly. He touched Acidalia’s skin. She stiffened, waiting for him to find a pulse. His fingers danced across her collarbone, her neck, and came to rest on her carotid artery. Acidalia felt her blood course through her veins, felt the man’s fingers press against her rapidly-beating pulse.
Slowly, the soldier rose. Acidalia didn’t move.
“She’s unconscious,” he said. “Not dead yet.”
Acidalia waited, tense. Three more men walked over, boots sloshing through the wetness on the ground. She kept her eyes downcast, her breathing shallow. Another man touched her neck with cold fingers. She felt the warmth of his breath on her shoulder, the uncomfortable sensation of his clammy, sweaty hands on her throat. Then he, too stood, and kicked her swiftly in the ribs.
She winced, moving into an upright position. Somewhere in the vapor, Aleskynn breathed a sigh of relief.
“Hands up,” the man said. “Now. Weapons on the ground.”
Acidalia tried to play it off as if she were unable to fully stand, subtly shifting her injured foot so that the blood spilled around her in a dark red circle. Any minute, Lyra…
“I said get up.” The soldier cocked his blaster gun, pointing it at her head. He was bluffing—he wouldn’t shoot her. Acidalia looked up into his eyes, . They were big and bold and blue, shiny underneath the light.
Look at me, Acidalia thought. Pity me. If people considered her human, they were far less likely to want to kill or hurt her. She stared right at him, eye-to-eye, fully aware that tears were streaking down her cheeks from the pain. A second passed, then two. The soldier’s expression softened.
“Get up,” he said again, but less demanding this time.
“Can’t you see I’m trying?” Acidalia asked, her voice ending in a pained, pathetic whine. She clutched at her side like a wounded animal, squeezing her blood-soaked shirt so that drops of blood dropped onto the floor. “I can’t stand.” Waiting, waiting…
The man adopted a vacant expression for a millisecond, then dropped to the ground, twitching. Behind him, Lyra dove into the mist again, her pink hair blending in with the pastel lights. All was quiet for a timepart, then the bomb went off, and the world turned into fiery mayhem.
The smoke was blinding, the silhouettes of the soldiers impossible to discern. The flare of bright laser bullets bounced around the lit-up room as they attacked one another, blind to their assailants. Screams echoed in the chambers, and the DNA terminals blinked softly. It felt slow, blurry, almost holographic, and not at all like the dangerous battle Acidalia knew it was.
Somewhere, glass shattered. One of the screens was blown out, and wires spilled onto the ground in a tangle of electric snakes. Voices sounded, but they were difficult to hear. Someone slid next to Acidalia, blaster drawn and helmet askew.
“I aimed for the head,” she said, smirking slightly.
“Nice,” Acidalia said. Lyra glowed. “I sent out the virus. Nobody knows yet, unless they see what I’ve done and decide to tell, but somehow I doubt my mother knows what her own people are doing. Now all we need to do is get the hell out of here.” She’d escaped death a second time, and there was no way she was giving up now.
Advertisement
- In Serial296 Chapters
Rebuild World
Akira, was born in the slum and wishes to get out but the only way he could was to risk his life in these ruin as a hunter. These ruins, known as the Old World, were danger zone where beast roam; buildings crumble, and other humans hunt their own… Though Akira had expected to face death countless times there, he had never expected to meet a naked woman there. Standing exposed with her curvaceous curves and bosom out for all to admire, Alpha, the breathtaking beauty stood there, looking back at him. This mysterious enchantress walked towards Akira and…
8 273 - In Serial6 Chapters
St. Charles and the Children from the Sun
This story is a tale classic in its tragedy, about the foibles of Man and how he destroys the things he loves, all to prove himself superior over the Universe. In a quest to defeat Hilter during Wold War II, Winston Churchill and Franklin Deleanor Roosevelt barter with a race of serpents who come from outer space. There are a few inconveniences for the leaders of the West when dealing with these creatures. For one, they can't even talk to them, for the aliens 'speak' by manipulating light. But in exchange for the knowledge of how to build an atomic bomb, all the monsters want from us is to live in peace at the bottom of the Pacific Ocean. What could go wrong with that? * * * This story is my entry in The Royal Road Community Magazine Contest * * *
8 206 - In Serial25 Chapters
The Swordmaster and the New God
People have always called me an optimist, someone who always sees what could be, instead of what is. I had always believed that doing the right thing was important and that I was doing my part one task at a time, starting at my school, Kobe High. One day, however, I, Kazuma Sato, and my best friend Austin Huber got teleported to another world. There, an angel spun a wheel to choose our class so we could help defeat the demon lord, and I got a never seen before class; god. Will we survive in the new fantasy world, where not all is as it seems, or will the secrets and true reason that we were summoned consume us?
8 168 - In Serial23 Chapters
Iridescent (E. Cullen)
Living on Asgard is supposed to be like living in paradise, but for Zenaida Swan, they are lonely golden halls. She misses her home of Forks, and she misses her father. Zenaida gets a call from Charlie that Bella has been in a car accident, she decides that it is time to go home.
8 134 - In Serial10 Chapters
The Legend of The Demon Prince
Kong Yue was born in a royal demon dynasty , had an abnormally high innate talent regarding elemental affinity. But was unable to cultivate all because he had a dantian which was already full to the brim with something. He was not able to absorb energy neither use the thing filling his dantian. Will he give up or continue tostruggle to become the strongest immortal ever?
8 65 - In Serial10 Chapters
Angelic Summons
We are called to; Struggle for supremacy. Survive this new world. Find our faith. On the advent of the system we will bear witness to the depths of our new power. Power we were never meant to have. And how it perverted us.
8 312

